Skip to content

What are the TruSeq oligos???

December 7, 2011

I have been meaning to post about this for a while but haven’t gotten around to it. There is substantial evidence that Illumina’s TruSeq PCR Primer Cocktail is not exactly what you would think by first guess. I have seen a trace of them (thanks Phillip!!!! – one of the best posters over on SeqAnswers) run on the Bioanalyzer and they appear to be very long. I, as well as others, have noticed that libraries made with ‘home-brew’ reagents require that you load more DNA onto the flow cell to achieve the same number of clusters as with samples made with genuine Illumina TruSeq reagents. This leads me to believe that Illumina’s PCR Primer Cocktail contain: 1) oligos that have additional sequence on their 5’ end that hang off the end of the adapter sequences that promote better binding to the flow cell and/or 2) some sort of modified base such as LNA residues that enhance binding to the flow cell.

This is more of a wild guess, but I think that it is possible that Illumina is using a new modification (LNA?) in their adapter sequences that inhibits the chewing back of the T-overhang and results in less adapter dimer formation.

Bottom line, if you are using a ‘home-brew’ protocol (such as my ChIP-seq library preparation protocol) you probably need to increase the amount of DNA you load onto the flow cell or if you are sending it out to be sequenced tell the facility that it is less concentrated than it really is.

Update: We, which as always means someone else, made two side-by-side TruSeq RNA libraries with the kit. One was with the adapters provided with the kit and the other was with adapters ordered from IDT. The libraries looked nearly identical on the Bioanalyzer. The library made with the oligos from IDT had a little less DNA but I think this was just some random variation.  So it does not appear that there is any magic with the TruSeq adapter oligos.  Which is good news because it means you can take the adapters from the kit which are methylated, replace them with unmethylated IDT oligos and use the adapters from the kit for RRBS-seq.

Advertisements

From → Posts

4 Comments
  1. Cristina permalink

    Hi Ethan,

    I plan to order from IDT primers to replace the Illumina’s PCR Primer Cocktail. Could you share the sequences? I´ve found quite a few different sequences, with and w/o modifications at 3´ends and I´m getting lost in all this searching.
    Thanks!
    C

  2. ethanomics permalink

    Hi Christina,
    Illumina considers the sequence of the PCR primer cocktail a trade secret and will not release it. Fortunately, it’s trivial to just synthesize your own. If you look at my ChIP-seq library preparation protocol, that is what I use and they work well. Some people make them longer but I don’t see a reason to do so. I do suggest you get the phophothioate modification, it’s cheap and there is a publication that says it helps. I just get standard desalting from IDT. No extra purification is necessary.

    For PCR use Kapa HiFi polymerase. It’s better then Phusion and way better then the polymerase Illumina has in their kits.

    https://ethanomics.wordpress.com/chip-seq-library-construction-using-the-illumina-truseq-adapters/

    Ethan

    From my protocol:
    TruSeq PCR 1 AATGATACGGCGACCACCGA*G
    TruSeq PCR 2 CAAGCAGAAGACGGCATACGA*G
    Note: The adaptor sequences are from Illumina. The PCR primer sequences are my best guess as to what Illumina is using in their PCR Primer Cocktail. To use more barcodes, simply change the highlighted sequence

    *=phosphothioate bond

    • Cristina permalink

      Thank you!

    • choying permalink

      Hi Ethan

      I’m Vivian, and I also want to older from IDT primers for Illumina’s PCR primer cocktail. So, thanks for sharing your protocol, but I have one question. Is it possible that If I only order one primer, PCR 1 or 2 and it still does the amplification? I want to ask is only one primer can use as forward primer and reverse primer, because both primer sequence could find in Illumina Y shaped adapters. I’m confused about this question, hope can give me some advice, I’ll appreciate. Thank you.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: