ChIP-seq libraries using TruSeq adapters
Now that were are getting 100 million reads/lane on the HiSeq2000, it’s time to barcode even for histone ChIPs. From what I see Bioo has some Illumina barcoded adaptors. There is also a good method published where you just add a barcode to the internal end of the adapters (http://www.ncbi.nlm.nih.gov/pubmed/19159457) but this method requires that you pool exactly four samples so that the nucelotides are balanced and the sequencer can calibrate itself. It also seems like it would be good to take advantage of the second read barcoding of TruSeq now that it is standard in most runs. But there is no TruSeq ChIP-seq kit available. I scoured the web and did not find any trace of evidence that people are using the TruSeq adaptors for ChIP-seq. So I figured why not just put together my own method. In the first try I got a ton of self-ligated adapter-dimers, so I assumed the Y-shaped adapter-dimers run really high in an agarose gel. I gave it another try, this time cutting higher in the gel and still ended up with a lot of adapter-dimer in the final library. So the third try, I added a step where I do a couple of cycles of PCR to convert the Y-shaped adapters to double-stranded DNA before the agarose gel size selection step and ended up with a nice smear and no adapter-dimer. So the question is, if it took me only three days to optimize this protocol (which I will add requires far fewer total PCR cycles than the non-barcoded ChIP-seq protocol from Illumina), why has Illumina not released anything for TruSeq ChIP-seq. Perhaps ChIP-seq is not the biggest section of the market, but it just seems stupid, especially considering the triviality and the fact that Life Tech has a ChIP-seq barcoded protocol.
Anyway, here is the protocol, let’s hope it works.
Ethan-omics 
Nice protocol, thanks for putting it out. We are planning to try this out ourselves. How crucial is the adapter concentration and adapter/template ratio? If we start with more than 10 ng do you suggest changing the adapter amount accordingly? Also, when you start with ChIPped DNA, how clean is it and how do you quantify it for 10ng?
Thanks
Nandita
Hi Nandita,
As far as the adapter/template ratio, I can’t really say how crucial it is as I have not exactly optimized it. If the adapter/template concentration is too high you will get adapter-dimers, so I would strongly recommend against going higher. I would guess that you could go much lower and it may even work better as the adapters are in substantial excess in the amounts I use in the protocol.
I quantitate my ChIP DNA with Invitrogen’s QuantIt HS DNA kit using a couple microliters of the ChIPed DNA. On an absolute scale, it may not be completely accurate especially down at such low concentrations but it does seem to reproducibly produce good libraries.
If you are using under 50 ng of DNA for your starting material I would probably use the same quantity of adapters since the adapters are in excess (I forget the exact ratio but it is easily to calculate). If you go much higher I would probably increase the adapters accordingly, but that is just my guess. I have never used more then 20 ng of starting material.
Good luck,
Ethan
I appreciate the protocol. I’m wondering what % adapter sequence you found in your final library using your modified protocol. I’ve tried the TruSeq kit for ChIP-seq and I also see huge adapter/primer contamination in my final sequenced library. Previous PE adapters didn’t produce these artifacts. Thanks.
Hi Ben,
Adapter-dimer contamination was the whole reason I put together the protocol. As I’ve posted, the TruSeq adapters in their Y-shaped form run really slowly though an agarose gel so you have to convert them to dsDNA before size selection. The adapter-dimer contamination I’ve had using my protocol is usually <1% and always <5%. Sometimes with native ChIP when I want to get mono-nucleosomal DNA I cut a little low and that has been when it has creeped up into the 3% range. It's also a good idea to use less adapters then the protocol says if your starting material is less then 10 ng.
Ethan
Hi Ethan,
I tried your protocol today and didn’t observe adapter dimers after the final PCR step. However, I noticed the final PCR smear seemed a little biased towards the lower molecular weight end (e.g. 250 bp region of smear more intense than 400bp region). I used to observe an evenly distributed smear with ChIP-seq libraries using the original Illumina PE adapter/primers. What did you specifically observe with your modified protocol?
thanks
Hi Ben,
I have not observed any size biases towards lower molecular weight fragments. In general, I would say it is better to retrieve the smaller fragments then the bigger ones (as long as you are not getting any adapter dimers), as it should increase resolution and decrease background. But in general I get a smear corresponding to the gel slice I cut out and biased in the direction of the overall chromatin fragmentation, which is the way it should be. I think with my protocol you are more likely to get the sizes of DNA you are actually trying to isolate because the DNA you are running through the argarose gel is double-straned, where as the original Illumina protocol has you running double-stranded DNA with Y-shaped adapters on the end.
Ethan
Hi,
Did you use the adapters/primers from the TruSeq RNA sample prep kit, or did you order your own adapters/primers? If you ordered your own, did you use the PCR sequences listed below? Also, did you PAGE purify your adapter sequences after annealing?
I ran your protocol again using components of the kit (adapters/primer cocktail) and I still observe a biased low MW PCR band (rather than a normal smear). Following Illumina’s protocol I see the appropriate smear distribution in the gel, but when sequenced it ends up being poor quality due to adapter contamination. Does anyone know the PCR primer sequences for the TruSeq RNA sample prep kit?
TruSeq PCR 1
AATGATACGGCGACCACCGA*G
TruSeq PCR 2
CAAGCAGAAGACGGCATACGA*G
thanks
All the primers I have used for my ChIP-seq library perparation protocol, I have ordered from IDT. I did not get any special purifications (HPLC or PAGE) but it is probably a good idea. Every other protocol I’ve reads says you should. The Illumina TruSeq PCR primers are proprietary and Illumina will not let them out. I’ve wanted to TA clone and sequence a TruSeq library to find out if there is any additional sequence they add but have not had the time.
I was thinking about this problem when I was jogging this morning and I thought that maybe it has to do with the fact that the agarose gel is not run very far and the DNA doesn’t resolve properly in such a short run. I usually cut a gel slice from 200 bp to 550 bp to try to get everything that can be sequenced.
The only other thing I can think of is the type of agarose you are using is different then what I use.